Sequence ID | >WENV170015625 |
Genome ID | AZIH01012421 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 312 |
End posion on genome | 385 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
acgacggagc |
tRNA gene sequence |
GCGGGTATGGTGAAATGGTATCATGCGAGCTTCCCAAGCTTAAGGTGCGGGTTCGATTCC |
Downstream region at tRNA end position |
cgttcggccc |
Secondary structure (Cloverleaf model) | >WENV170015625 Gly CCC c TCCA cgttcggccc G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A A A G | | | | | G T A G T G G C G G G C G | | | + T T G T C A T T A G AGGT C A G + T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |