Sequence ID | >WENV170015626 |
Genome ID | AZIH01012441 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1379 |
End posion on genome | 1454 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ctcaagacat |
tRNA gene sequence |
TCCGCCTTAGCTCAGTTGGTAGAGCAAATGACTGTTAATCATTGGGTCGCTGGTTCGAGC |
Downstream region at tRNA end position |
aataagagaa |
Secondary structure (Cloverleaf model) | >WENV170015626 Asn GTT t GCCA aataagagaa T - A C - G C - G G - C C - G C - G T - A C G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A GGGTC A - T A - T T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |