Sequence ID | >WENV170015636 |
Genome ID | AZII01000359 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 126 |
End posion on genome | 50 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccttcgtagc |
tRNA gene sequence |
AGGCACGTAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGGTGGTTCGAA |
Downstream region at tRNA end position |
attattttgg |
Secondary structure (Cloverleaf model) | >WENV170015636 Val GAC c ACCA attattttgg A - T G - C G - C C - G A - T C - G G - C T A T T C A C C A T G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |