Sequence ID | >WENV170015641 |
Genome ID | AZII01000538 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 4439 |
End posion on genome | 4514 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gcctcttgga |
tRNA gene sequence |
GGGTCGTTAGCTCAGCTGGTAGAGCACCGCACTTTTAATGCGATGGTCGCGCGTTCGAAT |
Downstream region at tRNA end position |
tcccaatcaa |
Secondary structure (Cloverleaf model) | >WENV170015641 Lys TTT a ACCA tcccaatcaa G - C G - C G - C T - A C - G G - C T - A T A T C G C G C A C G A A | | | | | G T C T C G G C G C G C G | | | | T T G G A G C T A A TGGTC C A C - G G - C C - G A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |