Sequence ID | >WENV170015644 |
Genome ID | AZII01000783 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 270 |
End posion on genome | 197 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cctcttttga |
tRNA gene sequence |
GGCTGGATGGCAGAGTGGTCATGCAGCGGACTGCAACTCCGTTAACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
ttattttaca |
Secondary structure (Cloverleaf model) | >WENV170015644 Cys GCA a TCCA ttattttaca G - C G - C C - G T - A G - C G - C A - T T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T C A TAAC G + T C - G G - C G - C A - T C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |