Sequence ID | >WENV170015646 |
Genome ID | AZII01000795 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 3252 |
End posion on genome | 3176 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
caaaaaagaa |
tRNA gene sequence |
GGGCCCTTAGCTCAGTTGGTTAGAGCATCCGACTCATAATCGGCAGGTCCCCAGTTCAAG |
Downstream region at tRNA end position |
tttcttgcca |
Secondary structure (Cloverleaf model) | >WENV170015646 Met CAT a ACCA tttcttgcca G - C G - C G - C C - G C - G C - G T - A T G T G G G T C A T G A A | | | | | A T C T C G C C C A G C G | | | | T T G G A G C T T A A AGGTC T C C - G C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |