| Sequence ID | >WENV170015651 |
| Genome ID | AZII01001150 |
| Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
| Species | |
| Start position on genome | 388 |
| End posion on genome | 464 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
aggtaattgt |
| tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCACTTGTCTGGGGGACAAGGGGTCGCAGGTTCAAA |
| Downstream region at tRNA end position |
atttcttatc |
| Secondary structure (Cloverleaf model) | >WENV170015651 Pro GGG
t ACCA atttcttatc
C - G
G - C
G - C
G - C
G + T
C - G
G - C T A
T T G T C C A
C G A A + | | | | A
C C G C G G C A G G C
T | | | | T T
G G C G C
G T A A GGGTC
C - G
T - A
T - A
G - C
T - A
C G
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |