Sequence ID | >WENV170015652 |
Genome ID | AZII01001225 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 823 |
End posion on genome | 898 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcgtttcaag |
tRNA gene sequence |
GGGTGGTTAGCTCAGTTGGGAGAGCAACGGCCTTACAAGCCGTAGGTCACAGGTTCGACC |
Downstream region at tRNA end position |
ttaagcattt |
Secondary structure (Cloverleaf model) | >WENV170015652 Val TAC g ACCA ttaagcattt G - C G - C G - C T - A G - C G - C T - A C C T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C G A A AGGTC A - T C - G G - C G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |