Sequence ID | >WENV170015658 |
Genome ID | AZII01001386 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 1101 |
End posion on genome | 1177 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ccgccccagt |
tRNA gene sequence |
GCCGCCTTAGCTCAGTAGGTTAGAGCGCTTGATTGTGGATCAAGAGGTCCCTGGTTCGAG |
Downstream region at tRNA end position |
ttaccccccg |
Secondary structure (Cloverleaf model) | >WENV170015658 His GTG t ACCA ttaccccccg G + T C - G C - G G + T C - G C - G T - A A G T G G A C C A T G A A | | | | | G A C T C G C C T G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A T - A G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |