Sequence ID | >WENV170015661 |
Genome ID | AZII01001626 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 189 |
End posion on genome | 265 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
caccatacat |
tRNA gene sequence |
GGCCCAGTGGCTCAGTTGGTTAGAGTGCCGGCCTGTCACGCCGGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
cttgctggtg |
Secondary structure (Cloverleaf model) | >WENV170015661 Asp GTC t GCCA cttgctggtg G - C G + T C - G C - G C - G A - T G - C T G T T T C C C A T G A G + | | | | G T C T C G G A G G G C G | | | + T T G G A G T T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |