Sequence ID | >WENV170015662 |
Genome ID | AZII01001626 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 269 |
End posion on genome | 343 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtcgccactt |
tRNA gene sequence |
GCTGGTGTGGCTCAATGGTAGAGCAGCTGATTTGTAATCAGCAGGTTGATGGTTCGATTC |
Downstream region at tRNA end position |
cattttcgga |
Secondary structure (Cloverleaf model) | >WENV170015662 Thr TGT t TCCA cattttcgga G - C C - G T - A G - C G - C T - A G - C T T T T T G C C A A A G + | + | | G T C T C G G A T G G C G | | | | T T G G A G C T A A AGGTT G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |