Sequence ID | >WENV170015663 |
Genome ID | AZII01001626 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 351 |
End posion on genome | 435 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ccacattttc |
tRNA gene sequence |
GGAGGAGTACCCAAGTGGCCAAAGGGGGCAGACTGTAAATCTGTTGCAAGTTGCTTCAGT |
Downstream region at tRNA end position |
caaaagacac |
Secondary structure (Cloverleaf model) | >WENV170015663 Tyr GTA c ACCA caaaagacac G - C G - C A - T G - C G - C A - T G - C T A T T C A C C A T G A A | | | | | G G A C C C A G T G G C G | | | T T C A G G G C A A G TGCAAGTTGCTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |