Sequence ID | >WENV170015665 |
Genome ID | AZII01001740 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 5571 |
End posion on genome | 5495 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
atccaactac |
tRNA gene sequence |
GCCTCCGTAGCTCAGCTGGATAGAGTAACCGGCTTCGAACCGGTTGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
tctttcagct |
Secondary structure (Cloverleaf model) | >WENV170015665 Arg TCG c GCCA tctttcagct G - C C - G C - G T + G C - G C - G G - C T A T C T C T C A C G A A | + | | | G T C T C G G G G A G C G | | | + T T G G A G T A T A A TGGTC A - T C - G C - G G - C G - C C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |