Sequence ID | >WENV170015670 |
Genome ID | AZII01002271 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 438 |
End posion on genome | 512 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
actggaatat |
tRNA gene sequence |
TCTTAGGTAGCTCAATGGTGGAGCAACCGGCTGTTAACCGGTAGGTTGTGGGTTCGAGTC |
Downstream region at tRNA end position |
gaaatgccgg |
Secondary structure (Cloverleaf model) | >WENV170015670 Asn GTT t GCCA gaaatgccgg T - A C - G T - A T + G A - T G - C G - C T G T C A C C C A A A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T G A AGGTT A - T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |