Sequence ID | >WENV170015675 |
Genome ID | AZII01002545 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 10451 |
End posion on genome | 10526 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tctgttcttg |
tRNA gene sequence |
GGGTGCTTAGCTCAGCTGGGAGAGCGTCGCCCTTACAAGGCGAATGTCGGGGGTTCGATC |
Downstream region at tRNA end position |
tttaggagtg |
Secondary structure (Cloverleaf model) | >WENV170015675 Val TAC g ACCA tttaggagtg G - C G - C G - C T - A G - C C - G T - A C T T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C G A G ATGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |