Sequence ID | >WENV170015679 |
Genome ID | AZII01002620 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 81 |
End posion on genome | 156 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aagtaatgtg |
tRNA gene sequence |
GTGGCCGTAGCTCAGTTGGTAGAGTCCAGGATTGTGATTCCTGTTGTCGCGGGTTCGATC |
Downstream region at tRNA end position |
ctcctatccc |
Secondary structure (Cloverleaf model) | >WENV170015679 His GTG g CCCA ctcctatccc G - C T - A G - C G - C C - G C - G G - C C T T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T A C TTGTC C - G A - T G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |