Sequence ID | >WENV170015680 |
Genome ID | AZII01002631 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 10614 |
End posion on genome | 10701 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
taagttttat |
tRNA gene sequence |
GGAGAGATGTCAGAGTGGCCGAATGAGCACGCTTGGAAAGCGTGTGTACCGCAAGGTACC |
Downstream region at tRNA end position |
ttaactgcaa |
Secondary structure (Cloverleaf model) | >WENV170015680 Ser GGA t ACCA ttaactgcaa G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G A C T G A G G G C G | | | T T C A T G A C G A G TGTACCGCAAGGTACC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |