| Sequence ID | >WENV170015680 |
| Genome ID | AZII01002631 |
| Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
| Species | |
| Start position on genome | 10614 |
| End posion on genome | 10701 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
taagttttat |
| tRNA gene sequence |
GGAGAGATGTCAGAGTGGCCGAATGAGCACGCTTGGAAAGCGTGTGTACCGCAAGGTACC |
| Downstream region at tRNA end position |
ttaactgcaa |
| Secondary structure (Cloverleaf model) | >WENV170015680 Ser GGA
t ACCA ttaactgcaa
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T C T C C C A
T G A G | | | | | G
G G A C T G A G G G C
G | | | T T
C A T G A
C G A G TGTACCGCAAGGTACC
C - G
A - T
C - G
G - C
C - G
T A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |