Sequence ID | >WENV170015685 |
Genome ID | AZII01002909 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 397 |
End posion on genome | 473 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
caatatcgta |
tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGTTAGAGCATGCGACTCATAATCGCCAGGTCCCCGGTTCGAG |
Downstream region at tRNA end position |
ttccgcttag |
Secondary structure (Cloverleaf model) | >WENV170015685 Met CAT a ACCA ttccgcttag G - C G - C G - C C - G C - G T - A T - A T G T G G G C C A T G A A | | | | | G T C T C G C C C G G C G | | | | T T G G A G C T T A A AGGTC T C G - C C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |