Sequence ID | >WENV170015686 |
Genome ID | AZII01002943 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 2554 |
End posion on genome | 2638 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agcaggttta |
tRNA gene sequence |
GCGGAAGTGGTGAAATTGGTATACACGCTGGTTTTAGGTACCAGTGCCGTAAGGCGTGGG |
Downstream region at tRNA end position |
actatttatt |
Secondary structure (Cloverleaf model) | >WENV170015686 Leu TAG a ACCA actatttatt G - C C - G G - C G - C A - T A - T G - C T G T C C C C C A T A A G | | | | | A T A G T G G G G G G C G | | | T T G A C A C T A T G TGCCGTAAGGCGT C - G T - A G - C G - C T - A T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |