Sequence ID | >WENV170015694 |
Genome ID | AZII01003391 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 985 |
End posion on genome | 903 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
acagataaaa |
tRNA gene sequence |
ACAAGGGTGGCTGAGTGGTTTAAGGCGGTGGCCTGTAAAGTCATTGTGGTGACACATCAT |
Downstream region at tRNA end position |
ttaaatagga |
Secondary structure (Cloverleaf model) | >WENV170015694 Tyr GTA a Attt ttaaatagga A C C - G A - T A - T G - C G - C G - C T A T T A T C C A T G A G | | + | | G G G T C G A T G G G C G + | | T T T A G G C T T A G TGTGGTGACACATC G + T T - A G - C G + T C - G C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |