Sequence ID | >WENV170015695 |
Genome ID | AZII01003391 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 856 |
End posion on genome | 783 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaaaatattT |
tRNA gene sequence |
ATTATCGTAGCTTAATGGTAGAGCGTCAACCTTCTAAGTTGTATGATATTGGTTCAAGTC |
Downstream region at tRNA end position |
ttaggaataa |
Secondary structure (Cloverleaf model) | >WENV170015695 Arg TCT T AAat ttaggaataa A - T T + G T - A A - T T - A C - G G - C T G T T A A C C A A A A | | | | | A T T T C G A T T G G C G + | | | T T G G A G C T A G ATGAT T T C - G A - T A - T C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |