Sequence ID | >WENV170015697 |
Genome ID | AZII01003416 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 2103 |
End posion on genome | 2028 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aatactattt |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGTCGACGGTTCGATC |
Downstream region at tRNA end position |
attcaataag |
Secondary structure (Cloverleaf model) | >WENV170015697 Ala TGC t ACCA attcaataag G - C G - C G + T G - C C - G C - G A - T C T T C T G C C A C G A A | | | | | G T C T C G G A C G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |