Sequence ID | >WENV170015698 |
Genome ID | AZII01003462 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 1083 |
End posion on genome | 1159 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tgtatcaacc |
tRNA gene sequence |
GCCCCGGTGGCACAGCTGGATAGCGCGGCCCCCTCCTAAGGGGCAGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
atcaatgacc |
Secondary structure (Cloverleaf model) | >WENV170015698 Arg CCT c ACCA atcaatgacc G - C C - G C - G C - G C - G G - C G - C T A T T C T C C A C G A G | | | | | G T C A C G A G A G G C G | | | T T G G C G C A T A G AGGTC G - C C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |