Sequence ID | >WENV170015699 |
Genome ID | AZII01003518 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 148 |
End posion on genome | 224 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gccagttcat |
tRNA gene sequence |
CGGGGAATAGCGCAGTCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ttattagtgg |
Secondary structure (Cloverleaf model) | >WENV170015699 Pro TGG t ACCA ttattagtgg C - G G - C G - C G - C G - C A - T A - T T A T C T C C C A T G A A | + | | | G C C G C G G G G G G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |