Sequence ID | >WENV170015703 |
Genome ID | AZII01004048 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 1122 |
End posion on genome | 1209 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cggctcgaaa |
tRNA gene sequence |
GGAGGGGTGGCTGAGTGGCCGAAAGCACCGGTCTTGAAAACCGGCGACGGGAGACCGTCC |
Downstream region at tRNA end position |
ttttgctaaa |
Secondary structure (Cloverleaf model) | >WENV170015703 Ser TGA a GCCA ttttgctaaa G - C G - C A - T G - C G - C G - C G - C T A T G T C C C A T G A G | | | | | G G G T C G C A G G G C G | | | T T C A A G C C G A A CGACGGGAGACCGTCC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |