| Sequence ID | >WENV170015704 |
| Genome ID | AZII01004055 |
| Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
| Species | |
| Start position on genome | 130 |
| End posion on genome | 204 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
ttaaagttgc |
| tRNA gene sequence |
TGGGGTGTCGCCAAGTGGTAAGGCAACGGGTTTTGATCCCGTCATTCGCAGGTTCGATCC |
| Downstream region at tRNA end position |
attctgattg |
| Secondary structure (Cloverleaf model) | >WENV170015704 Gln TTG
c GCCA attctgattg
T - A
G - C
G + T
G - C
G - C
T - A
G - C C T
T C G T C C A
G A C | | | | | G
T A C C G G C A G G C
G | | | T T
G A G G C
T A A CATTC
A - T
C - G
G - C
G - C
G - C
T T
T A
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |