Sequence ID | >WENV170015704 |
Genome ID | AZII01004055 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 130 |
End posion on genome | 204 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttaaagttgc |
tRNA gene sequence |
TGGGGTGTCGCCAAGTGGTAAGGCAACGGGTTTTGATCCCGTCATTCGCAGGTTCGATCC |
Downstream region at tRNA end position |
attctgattg |
Secondary structure (Cloverleaf model) | >WENV170015704 Gln TTG c GCCA attctgattg T - A G - C G + T G - C G - C T - A G - C C T T C G T C C A G A C | | | | | G T A C C G G C A G G C G | | | T T G A G G C T A A CATTC A - T C - G G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |