Sequence ID | >WENV170015712 |
Genome ID | AZII01004265 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 143 |
End posion on genome | 68 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
catcttagat |
tRNA gene sequence |
GCCCAGATAGCTCAGTCGGTAGAGCAGTGGACTGAAAATCCTCGTGTCGATGGTTCGAAT |
Downstream region at tRNA end position |
tttgttataa |
Secondary structure (Cloverleaf model) | >WENV170015712 Phe GAA t ACCA tttgttataa G - C C - G C - G C - G A - T G - C A - T T A T C T G C C A T G A A | | + | | G C C T C G G A T G G C G | | | | T T G G A G C T A A GTGTC G - C T T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |