Sequence ID | >WENV170015713 |
Genome ID | AZII01004274 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 742 |
End posion on genome | 666 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcaaaattat |
tRNA gene sequence |
GGCGAGGTAGCTCAGTCGGTTAGAGCGTCGGATTCATAACCCGGAGGTCACGAGTTCAAT |
Downstream region at tRNA end position |
caataaaagt |
Secondary structure (Cloverleaf model) | >WENV170015713 Met CAT t ACAA caataaaagt G + T G - C C - G G - C A - T G - C G + T T T T T G C T C A T G A A | | | | | A C C T C G A C G A G C G | | | | T T G G A G C T T A G AGGTC T + G C - G G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |