Sequence ID | >WENV170015718 |
Genome ID | AZII01004844 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 9354 |
End posion on genome | 9430 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tgaaggaagt |
tRNA gene sequence |
CGGGGTGTAGCGCAGCCTGGTAGCGCAACTGCTTTGGGAGCAGTGGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
atttttactt |
Secondary structure (Cloverleaf model) | >WENV170015718 Pro TGG t ACCA atttttactt C - G G - C G - C G - C G - C T - A G - C T A T C T C T C A C G A A | + | | | G C C G C G G G G A G C T | | | | T T G G C G C G T A A GGGTC A - T C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |