Sequence ID | >WENV170015725 |
Genome ID | AZII01005223 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 6521 |
End posion on genome | 6606 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cacggtcacc |
tRNA gene sequence |
GCCCGGGTGGCGAAATTGGTAGACGCAACGGACTTAAAATCCGTTGACCTTTGGTCGTGC |
Downstream region at tRNA end position |
gcttttatcc |
Secondary structure (Cloverleaf model) | >WENV170015725 Leu TAA c ACCA gcttttatcc G - C C - G C - G C - G G - C G - C G - C T G T C G C C C A T A A G | | | | | A T A G C G G C G G G C G | | | T T G A C G C T A G A TGACCTTTGGTCGT A - T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |