Sequence ID | >WENV170015727 |
Genome ID | AZII01005235 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 184 |
End posion on genome | 259 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aattagcact |
tRNA gene sequence |
GGTGCCTTAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCCCTGGTTCGATT |
Downstream region at tRNA end position |
gaaaaccctg |
Secondary structure (Cloverleaf model) | >WENV170015727 Phe GAA t ACCA gaaaaccctg G - C G - C T - A G - C C - G C - G T - A T T T G G T C C A T G A A | | | | G T C T C G C C T G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |