Sequence ID | >WENV170015728 |
Genome ID | AZII01005273 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 271 |
End posion on genome | 360 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
acgcgtcggt |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTAGGCCCGGAAGGGTC |
Downstream region at tRNA end position |
taacacgcta |
Secondary structure (Cloverleaf model) | >WENV170015728 Ser GCT t GCCA taacacgcta G - C G - C A - T G - C A - T C - G G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TAGGCCCGGAAGGGTCTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |