Sequence ID | >WENV170015737 |
Genome ID | AZII01005562 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 1733 |
End posion on genome | 1808 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tatagcaatt |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCGCCGGTTCGAAC |
Downstream region at tRNA end position |
atttatcgtc |
Secondary structure (Cloverleaf model) | >WENV170015737 Gly GCC t TCCA atttatcgtc G - C C - G G - C G - C G - C A - T A - T C A T T G G C C A T G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T A G AGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |