Sequence ID | >WENV170015742 |
Genome ID | AZII01005870 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 124 |
End posion on genome | 200 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cactgcttca |
tRNA gene sequence |
GCCCCGGTAGCTCAGTTGGATAGAGCAAGCGCCTCCTAAGCGCTAGGTCGGACGTTCGAA |
Downstream region at tRNA end position |
tcttcccgct |
Secondary structure (Cloverleaf model) | >WENV170015742 Arg CCT a ACCA tcttcccgct G - C C - G C - G C - G C - G G - C G - C T A T T C T G C A T G A A + | | | | G T C T C G G G A C G C G | | | | T T G G A G C A T A A AGGTC A - T G - C C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |