Sequence ID | >WENV170015743 |
Genome ID | AZII01005966 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 2142 |
End posion on genome | 2217 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cctcctctga |
tRNA gene sequence |
GGGCCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCCTGGGTTCGAAT |
Downstream region at tRNA end position |
ttttcaatat |
Secondary structure (Cloverleaf model) | >WENV170015743 Lys TTT a ACCA ttttcaatat G - C G - C G - C C - G C - G G - C T - A T A T G G C C C A T G A A | + | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |