Sequence ID | >WENV170015744 |
Genome ID | AZII01006163 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 1009 |
End posion on genome | 933 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gccgccctct |
tRNA gene sequence |
GCACTCGTAGCTCAGCTGGATAGAGTACCCGGCTACGAACCGGGCGGTCGAAGGTTCGAA |
Downstream region at tRNA end position |
tcttttacac |
Secondary structure (Cloverleaf model) | >WENV170015744 Arg ACG t GCCA tcttttacac G - C C - G A - T C - G T - A C - G G - C T A T C T T C C A C G A A | | | | | G T C T C G G A A G G C G | | | + T T G G A G T A T A A CGGTC C - G C - G C - G G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |