Sequence ID | >WENV170015747 |
Genome ID | AZII01006279 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 280 |
End posion on genome | 207 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ggggagtgtt |
tRNA gene sequence |
GCGGGTATAGTTCAGTGGTAGAACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCC |
Downstream region at tRNA end position |
gatcccgttc |
Secondary structure (Cloverleaf model) | >WENV170015747 Gly TCC t TCCA gatcccgttc G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A G A A | | | | | G T C T T G G C G G G C G | | | | T T G G A A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |