Sequence ID | >WENV170015751 |
Genome ID | AZII01006423 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 673 |
End posion on genome | 598 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ataaccactt |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTTATCGCGCCGCGTTTGGGACGCGGAGGTCGCAGGTTCGA |
Downstream region at tRNA end position |
aaattaagcc |
Secondary structure (Cloverleaf model) | >WENV170015751 Pro TGG t ACag aaattaagcc C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A C C G A A | | | | | G C T G C G G C A G G C G | | | T T G T C G C T T A G AGGTC C - G C - G G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |