Sequence ID | >WENV170015760 |
Genome ID | AZII01006899 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 472 |
End posion on genome | 556 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agcccgcttg |
tRNA gene sequence |
GCGGACGTGGTGAAATTGGTAGACACACCAGATTTAGGTTCTGGCGCCGCAAGGTGTGAG |
Downstream region at tRNA end position |
tgtgaaaagc |
Secondary structure (Cloverleaf model) | >WENV170015760 Leu TAG g ACCA tgtgaaaagc G - C C - G G - C G - C A - T C - G G - C T G T C T C T C A T A A G | | | | | G T A G T G G A G A G C G | | | T T G A C A C T A G A CGCCGCAAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |