Sequence ID | >WENV170015761 |
Genome ID | AZII01007065 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 2379 |
End posion on genome | 2295 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tagagttttt |
tRNA gene sequence |
GCCCAAGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGTAAGCCGTGCC |
Downstream region at tRNA end position |
tttatgccct |
Secondary structure (Cloverleaf model) | >WENV170015761 Leu GAG t ACCA tttatgccct G - C C - G C - G C - G A - T A - T G - C T G T C G G C C A T A A G | | | | | A T G G T G G C C G G C G | | | T T G A C A C T A G G TGGCGTAAGCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |