Sequence ID | >WENV170015764 |
Genome ID | AZII01007228 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 644 |
End posion on genome | 720 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcgattttga |
tRNA gene sequence |
TGCGGGGTGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
cttagatgaa |
Secondary structure (Cloverleaf model) | >WENV170015764 Met CAT a ACCA cttagatgaa T T G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | + | | | A C C G A G G T A G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |