Sequence ID | >WENV170015766 |
Genome ID | AZII01007963 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 149 |
End posion on genome | 73 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ctctatggat |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCACCTGTTTTGGGTACAGGGGGTCGTAAGTTCGAA |
Downstream region at tRNA end position |
taaaatctcc |
Secondary structure (Cloverleaf model) | >WENV170015766 Pro TGG t ACCA taaaatctcc C - G G - C G - C G - C G + T C - G G - C T A T C A T T C A C G A A | | | | | G C C G C G G T A A G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |