Sequence ID | >WENV170015767 |
Genome ID | AZII01008018 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 574 |
End posion on genome | 485 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gcttaaaact |
tRNA gene sequence |
GGAGAGATGGCAGAGCGGTTGAATGCACCGGTCTTGAAAACCGGCAAGGGGTCAAACCCT |
Downstream region at tRNA end position |
ttcaaaagcc |
Secondary structure (Cloverleaf model) | >WENV170015767 Ser TGA t GCCA ttcaaaagcc G - C G - C A - T G - C A - T G - C A - T T A T G T C C C A C G A G | | | | | G G G A C G C A G G G C G | | | T T T A T G C T G A A CAAGGGGTCAAACCCTTC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |