Sequence ID | >WENV170015771 |
Genome ID | AZII01008327 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 821 |
End posion on genome | 908 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tgagacactc |
tRNA gene sequence |
GGAGAATTGGCAGAGTGGTCGAATGCGGCAGTCTTGAAAACTGTTGAGGGTCACACCTCC |
Downstream region at tRNA end position |
aaccttgtaa |
Secondary structure (Cloverleaf model) | >WENV170015771 Ser TGA c GCAA aaccttgtaa G - C G - C A - T G - C A - T A - T T - A T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G | | | T T T A T G C C G A G TGAGGGTCACACCTCC G + T C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |