Sequence ID | >WENV170015772 |
Genome ID | AZII01008400 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 120 |
End posion on genome | 196 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acagcattgt |
tRNA gene sequence |
CGCGGGATGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCGAA |
Downstream region at tRNA end position |
atttaaaaag |
Secondary structure (Cloverleaf model) | >WENV170015772 Met CAT t ACCA atttaaaaag C A G - C C - G G - C G - C G - C A - T T A T C G T C C A T G A G | + | | | G C C G A G G T A G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |