Sequence ID | >WENV170015776 |
Genome ID | AZII01008512 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 17140 |
End posion on genome | 17213 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agtcctctct |
tRNA gene sequence |
GGCTGAGTGGCAGAGTGGTTATGCAGCGGCCTGCAAAGCCGTGTACAGCGGTTCGATTCC |
Downstream region at tRNA end position |
tgtcggaatt |
Secondary structure (Cloverleaf model) | >WENV170015776 Cys GCA t TCCA tgtcggaatt G - C G - C C - G T - A G - C A - T G - C T T T T C G C C A G A G | | | | | G T G A C G A G C G G C G | | | T T G A T G C T T A GTAC G + T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |