Sequence ID | >WENV170015781 |
Genome ID | AZII01009019 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 382 |
End posion on genome | 455 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ggtcacaaaa |
tRNA gene sequence |
GGTGTCGTGGCCGAGTGGCTAGGCAGTGGTCTGCAACACCATCTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
aaagagttac |
Secondary structure (Cloverleaf model) | >WENV170015781 Cys GCA a TCAA aaagagttac G - C G - C T - A G - C T - A C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T A CTAC G + T T - A G - C G - C T - A C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |