Sequence ID | >WENV170015785 |
Genome ID | AZII01009120 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 459 |
End posion on genome | 534 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agtcgaatag |
tRNA gene sequence |
CGCGGGATAGAGCAGTAGGTAGCTCGTCGGGCTCATAACCCGAAGGTCACTGGTTCGAGT |
Downstream region at tRNA end position |
agtttacctt |
Secondary structure (Cloverleaf model) | >WENV170015785 Met CAT g ACTA agtttacctt C T G - C C - G G - C G - C G - C A - T T G T T G A C C A T G A A | | | | | G A C G A G A C T G G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |