Sequence ID | >WENV170015793 |
Genome ID | AZII01009761 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 10186 |
End posion on genome | 10262 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ttaattccat |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCACCAGTATGGGGTACTGGTGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
aatttacaac |
Secondary structure (Cloverleaf model) | >WENV170015793 Pro GGG t ACCA aatttacaac C - G G - C G - C G - C G - C C - G G - C T A T T C T C C A C G A A + | | | | A C C G C G G G A G G C T | | | | T T G G C G C G T A A TGGTC C - G C - G A - T G - C T - A A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |