Sequence ID | >WENV170015795 |
Genome ID | AZII01009827 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 270 |
End posion on genome | 357 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
acgacaatct |
tRNA gene sequence |
GGTGAGGTGTCCGAGTGGCCGAAGGAGCACGCCTGGAAAGTGTGTATACCGCAAGGTATC |
Downstream region at tRNA end position |
aacatgaaaa |
Secondary structure (Cloverleaf model) | >WENV170015795 Ser GGA t GCCA aacatgaaaa G - C G - C T - A G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T C A G G A C G A G TATACCGCAAGGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |